Ready.
Opposition to witch-burnings seem to be mostly about "what if not really a witch?" The evil may endorse witchcraft, any way, but non-evil people may like to kill them. Now, instead of setting fire to a stake, we may have a God-sent method, if He sets some epigene of the evil-doers, to facilitate detecting-&-burning them, without any need for external (coal, oil, wood, etc) sources of fire. That is, if the evil is set to a burnability-state, then that is sufficient for the elimination, a punishment button that you may just press. (Detection ability is valuable, too.)
For example, if ENSR00000140270 is the epigene (transcription factor) that Allah uses to stain the evil ones (thought-controllers-&-conspirators, the antichrist gangs, the maximum-hell-bound unredeemable evil), then we may build detectors (and/or witch-burners that kill (maybe remotely, too)) by using what that epigene enables.
A theory I have is that, in theory, there exists some mechanism to trigger burning any human, but there is also some mechanism to make it not happenable, and that epigene (transcription-factor) is simply obstructing the latter (that is, nothing turns off the fire once it starts). It resembles how, in theory, every human could be burnt in hell, but lots of us go to heaven, without even appearing in Judgment Day court-room, and there are even (few) that go to hell but (for some reason) protected there from the fire. It also reminds of how greedily those evil ones have tried to invade lots of influential positions (that you would otherwise normally expect relief through, such as state-job positions and even the minds of lots of people from whom humans really would expect help), and how they ruined lots of people (ruined-through-obstruction-of-their-free-wills, replacing with evil suggestions, to a large extent).
BTW, one very sensible conspiracy theory is that, those who do thought-control, also happen to be those who do the evil of the World, through other means, too (Protocols-of-Zion, masonism, etc). As such, eradicating them (through such an epigene, or whatever sure-fire method that spares the rest of us), would be the immediate method to convert the World from the worst-of-times to best-of-times (with the strictest, most direct definition), because whatever good resource or person is created by Allah, then the evil gangs try to (and, at least, when trusted, have been "successful" at) using it toward making the World a worse place (such as printing-press, electronics, alcohol-prohibition, democracy, law-courts, etc).
So, other than sending a band of angels, or doing big miracles (maybe designating the Mehdi (a.s.) or Jesus (a.s.) as the miracle-handed personnell), even the God may have seemed to have no way to help humanity, because whatever He does for good, the humanity has been giving it away to the evil, like you know that every thing you give to your children, will be extra cause for them to be harmed next day, either swindled or bullied from them, when you send them to school. But He may have designed the irony into the biology beforehand, and simply turning off the fire-extinguisher, as such, making the (genetic) states of those evil swindlers/bullies become their stakes prepared to burn themselves.
Knowing the list of evil, is good for disqualifying them (from your personnell list, friends list, etc). Also, having that extra information, may help in finding out who committed a crime (or, point out that some normal-looking event was actually a crime, such as a witch-controlled relationship being a rape), once you find out the list of thought-controllers-&-conspirators (the maximum-hell-bound evil) that Detecting the evil ones as well as for finding out if there trouble is caused by a nearby evil. the evil that would otherwise s may have been the criminals of the events you have known, too.
[1] ebi.co.uk (2017). "Regulatory Feature: ENSR00000140270 - Summary - Homo sapiens - Ensembl genome browser 90" Retrieved October 17, 2017
[2] The genome sequence as retrievable through the URL "http://rest.ensembl.org/sequence/region/human/21:10014722..10015143:1?" (retrieved with R 3.4.1, with REST methods suggested by http://rest.ensembl.org/documentation/info/sequence_region ), was (on Oct.12,2017):
TCTTTGAAATATA A TTCACATATAAA AATTTCAGAAAATTTTAAGGACCTTTTTCT TTTTACTAATGCTTTGATTAGGATTTCAGT CTGCATACGAATTTGTCATGATTTTAGCTG AAACTATTTAAATAGATCGCCGCCGGGAAA AAAGGCGGGAGAAGCCCCGGCAGGTTTGAA GCTGCTTCTTCGAATTTGCAATTCAATATG AAAATCACCTCAGAGCTGGTAAAAAGAGGC TTAACCCCTGTCTTTAGATTTACAGTCCAA TGCTTCACTCAGCCATTTTACCTCACCAGA TCAATACCTTTCCTTATCTCTCAATGTCAT TAGATATATACATTTTAATCTTAATTTATA GAACAAATATACATATCTTTTTCTGATTAT GTGCCTCTAAGTTTGGTAAAAAGTTCTTGA TGCAAC